EY675313

Overview
NameEY675313
Unique NameEY675313
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length942
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-009-A01-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY675313 ID=EY675313|Name=EY675313|organism=Citrus sinensis|type=EST|length=942bp
AAGGGAAGCAGGTCGGGAATTCCGGGGTCAACCACCCGTCCGCCGCGAGT
GAAAGAAAGGACCCCTTTATAAAATTGGTTTTCTAGTGATGATATTAATG
CCCCCTAAAAGATAACTGGCCGTCTAAGGAGATTAAAAGAGAATGTGGGA
TTTATAACAAACCGTGTAACGGCAATTCCCGCTGGTCTTGATAGCTGGCA
GGCTGAACAAATAAATAGAAAACTCTATTATCTCTCGTTCCTTTCAATAG
CATTGCTTCCTTTATCCATCATCACTGGAGTTTTTGGAATGAATGTGGGA
GGAGTCCCATGGACATTGCAGGAGGAACCAAAAGATGGTTTCAAAAACGA
TGTATTTCTCTGTGTAGGAATGCTACTACTGGTGCTGCTATGCTTCCTTT
TGACAGCTGCTTATAGACAAGAAAGCTGCTTAGAAACAGAAGAAGACTAT
GTAAAGAAAGCTGGGAGAAAAAAAAAAAATCATTCCTCAGAAAACCGTTG
GAATTCAAGTTCTAGAAAAAGAAGTTACATTTGAATTTTAAACCAAACAG
AATCCTAAGACTGACCTTCCCTGGTCTTAGGCTCCTAATATTTATAAAAA
CTAGTAAACCAAGCCTTCTTAAATGAAAAATTATAGTAATAAACACCCTT
AACAGATTAGAAAAAAAAAAGAACAAGAAATGATAACCAGCCGGGAATTG
AAGGGGGAAATTCTAAGAAATTTATATAAATATAGTATAATTTTTTAGAA
TACAAACATATGAGATAAAAATCAACGTGTCATATATTTTTGTCAGAAAC
AAGGATTATTATAAAAAAATTATTTTTATTAATATTTAAAAAAGACTATT
TAGAGCACGAGAAACACATATTGATAACTATAATCACATAATTACAGAGG
GAACTTGATTTATAATGAAGAGTATAAATAGAGAACAACAAA
back to top