EY675306

Overview
NameEY675306
Unique NameEY675306
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length186
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-008-H06-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY675306 ID=EY675306|Name=EY675306|organism=Citrus sinensis|type=EST|length=186bp
ACCGGCGGGTCCGGGTCCGGATTCCCGGGTCGACCTCGGGCAGGCTGCGC
ATCGCCTCGCCCCTTTGCTCGCGGGCGCGTTCGGCCTGGAACTTCATCAC
GCCCTAGAAGCGCTCGGAATATTCGCCATTCAGGATGTCCGAGGCCTTGA
CCTCGAACTGCTGCATGTCGTTGACCCGGATGTAGA
back to top