EY674771

Overview
NameEY674771
Unique NameEY674771
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length384
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-001-C03-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY674771 ID=EY674771|Name=EY674771|organism=Citrus sinensis|type=EST|length=384bp
CGTGGCGGGTACCGAGTTCGGGAATTTCCAGGGTCGACCCACGTCGTCCG
AAAAAGTTCAAAATTCACCCAAAGAATGACTTTATGGTTTTCTAATTTTA
GTGAATTTCCTCAAAACCCGCATGATTTATCAAAAAAAAATTAAAACCCT
GTAAAATTATTCATAGGAATCAATTTGTATTATTCTCGTATATTATGGTG
TTTATTTCTAAAGCATTTCAAATAAAAGTGGAACTATTGGTACCCCTCTA
AATACCTCTTAACACCCATTTTCTTTATTAACCTCATTAAAATATTTAAA
ATTATTATAAAATTGTTTTAACACCACCTTCGATTAAAAAGAAAAAGAAA
AAAAATAAAGGAGAAAAAAAAAAAAACCATCGCA
back to top