EY674768

Overview
NameEY674768
Unique NameEY674768
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1087
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8506 contig Csv1_Contig8506:1..1087. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange leaf, infected with CiLVcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C1-401-001-B12-CT.F Sweet orange leaf, infected with CiLV Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY674768 ID=EY674768|Name=EY674768|organism=Citrus sinensis|type=EST|length=1087bp
GGCAGGTAACGGTCCCGGAATTCCCGGGCCCCGCGTCCGCTTTTTTTTTT
CTTGAGTAACCACTTTCACCATGGAACTCACTTGAAATCAAAAGATCTTC
GACACCAAAATAAAGAATTTTTTTTTTTTTTTTTTGGTTTGGTTGTTTTT
GGTTCTGGCCTTGTGGGTATTTGTTTTGTTTTCGTTGTTTTGAAAATGGT
TTCTTTAGAAGATTCTCAGTCGACTTCAAATCGTTTCCCTTTGAGACAAA
ACTTGTACACTCCACCTTCAGCCTCTTCAACAAAAATCCATCGAAGTATC
GGACGATCGATGCGTACGATACGCTCAAACCTCTACCAAACTGATAATAG
CTGTTCCTTCGTTTCGGTTCCCGATAACTCGGGCTACTTGTCTGAAAACC
TTACTGAATCAATCATCGATATGAGGCTCGGTGAGCTCGCATCCAAAACC
AACGACGCCAAATCTGTGAAATCCCACTATCTCGGAAGACAATTACTTGA
AAGTTTCTCAAGCCTTTAGCGATTTCCCGGTCTGTAACAACCATATTTCG
GGGCAATTACACCGTTCTTGCCAACTTAACCATCTCCCCGAAAATTTCCC
CCGTCAACCAATGAAAAATAATTGCCAAGCTGAAATTGAAACCAGAACCC
GGGGCCCTGGTTTGGGCCTTCCTTCCAAGGGAAAAATTTTTTCACCCAAA
AAAAACAAAAGCATCTCGCCCGGAAAAATCTTCACCCCAAAGGTCAAAAA
TTTGATTTGACAGGTTTTGAATACCTTCATCCGTTGAACCTTTAAAAAAA
TATCACAGCGGGGAGAAAACCTTTAAATTTTTTTTCACAAAAAAATCTGG
TCCCCAAAATAATGGGGGGGGTTATATCCCAAGAAAAAATGAGGGGGGGT
GTCCCCCCCGACCTTTATTTCCCCCCTTTTTTTATAATAAATAGTTACAA
CCCCCCCCCGAGGAGAACCACACAAGAAAATATTTTTAAAGGAGAAGAGC
GGGTTTTTTTTTTTTTAAAACCACATCTTTCTCTCCTTGGCGAAAAATGA
TAAAAAAAAAAATAAAATAGAAAAAACACCACACCAC
back to top