EY684963

Overview
NameEY684963
Unique NameEY684963
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length445
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-005-H09-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684963 ID=EY684963; Name=EY684963; organism=Citrus sinensis; type=EST; length=445bp
GGGGGTTACCCAATTTATTCCCTTTGCAGAACTTCCCCTTTTCCCCCGTG
GGGAAAAAAAAAAAAAGGCCCCCCCCGATCCCCCTTCCACAAATTTGCCC
ACCCTGAAGGGGAAAGGGGACCCCCCCTGTACCGGGCCCTTTAGCGGGGG
GGGGGGGGGGGGGGTCCCCCACACGGGAACCGCCCAATTTCCAGACCCCC
CAAACGCAATCTTTTTTTGTTTTTATTCCTTTTTTTTTTTTCCGCGGGTG
GAGGGGGTTTTCCACTAGGAGCTCTAAAAAGCGGGGGGGAGCCCCTTTTA
GGGCCGACGACAATTCAGCTCTTTTGGCGCCACCACAGACCCCAACAAAA
ACCTAGCCAACAGCTATTTGGACATCACAACCAGAGACGTCACCGCACAA
CAACACAAAGCAAGCGACTCAACACAGCGAACGCGGGGACGGGAA
back to top