EY702701

Overview
NameEY702701
Unique NameEY702701
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length935
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY702701_ssr109 microsatellite EY702701_ssr109:109..124. BLAST: Citrus ESTs to Prunus persica proteins V1
EY702701_ssr903 microsatellite EY702701_ssr903:903..914. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig9996 contig Csv1_Contig9996:1..933. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange fruit, development stadium (2 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-701-011-C06-CT.F Sweet orange fruit, development stadium (2 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY702701 ID=EY702701|Name=EY702701|organism=Citrus sinensis|type=EST|length=935bp
TTTCGTCGACCCACGCGTCCGCACCACTACATTACACCCCACCCACTTTT
TTTCCCTCTCACTTTCTCGAGAAAATTAAGTCTTTTCTTCCCAGAAGAAA
GTTTCATTTTTCTTTCTTTCTTTCCTTTTTTTTTTCCTTATTTCTCCATT
AATCATGATGATGATCAATAGCAGCAATCGTGATCATCAAGAACTGCTCA
CTGTAAGAGAATTCAAGCCCAAGAACCGAAGAATCATGGGAGGAGGAGGG
CCGGAAGAAGAAGATGAAGAAATGAGCAATAAGTGGCCGCCGTGGCTGAG
GCCTCTGCTACAAACGAGCTTCTTCGTTCAATGCAAGCTCCATGCCGATG
CTCACAAAAGTGAATGTAACATGTACTGCTTGGACTGTATGAATGGTGCT
CTCTGCTCGCTATGTCTCTCACTTCACAGAGACCACAGAGCAATCCAGAT
AAGGAGATCATCATACCACGATGTGATCAGGGTTTCGGAGATTCAGAAGT
ACCTGGATATAACAGGAGTTCAAACGTATATCATAAACAGCGCAAGAATT
GTCTTCTTGAATGAAAGACCTCAGCCCAGGCCTGGTAAAGGCGTCACAAA
TACTTGTCTTGTTTGCGAACGCAGCCTCCTTGATTCCTTCACTTTCTGCT
CCCTTGGCTGCAAGATTGCGGGGACATCAAAGAAATTTCAGAAAAGGAAA
ATGTGCAAGGAAATGGATCAAGGATCGGATGCTGAGATTAGCAGCAATAA
CGGGAGTTCAAAGAGCAGGACACACAGCTTTTTCGCCGTCGACGCCGCCG
CCGACGGGCGTGAGTTTCAAGACTGCCAAGAAGAGAAAGGGGGTCCNTCA
TAGAGCTCAATGGGAGGTTTACTCTTGGATACTAGAATAGGGGTTTACAT
AAAATTAATTAATTAAAAATTGAAAATGAAAATGG
back to top