EY702698

Overview
NameEY702698
Unique NameEY702698
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length572
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3694 contig Csv1_Contig3694:776..1347. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Sweet orange fruit, development stadium (2 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-701-011-C03-CT.F Sweet orange fruit, development stadium (2 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY702698 ID=EY702698|Name=EY702698|organism=Citrus sinensis|type=EST|length=572bp
TTTCTCGACCCCGCGTCCGGAAGAGGGGGTTGGCACATTTATACTCTGCT
CTGGAAGAATATCAATCCATTAGGAAACCTGTAACTTCAGCACAAGTTCT
ACATTCGCGACGATTGGGTCAAATGAAACAAGGGTTAAGTATTCCTGGAA
GGGAGCGGCCTTTTGATCCAAAGACAGCAAGTCTAGAGGACTCGGAATTC
ATCGTTGTGCCTCCTTTCGACGTTGTTCCTCCGATTCTTGATTCAATTTT
TCGTTCTGCTTGATAACTTCAAAGGACACGGCTTGGTCTGTTCATTATGC
TAACTATAGCTGCCTATAAATAAGAGGGTTGACCTCAATTGTGTGAGTAA
AAGAACTGCTATACTTATGTTCCTTCCTGTAATAACGAAAGCCTCTTACT
TAATTCAGTGTCTCTACTTCTTCAGCAAAATAAAAATAAATTCTTGATCG
AAAAAAAAAAAAAAAAAAAGGGCGGCCGCCCTTTTTTTTTTTTTTTCTAA
TGAGGAATAGTGACGAAAAATAATCTCAAAGCTCGATCAAGCGCATGTGG
GGTTCGTTTTCCTCTGCAAAAA
back to top