EY702106

Overview
NameEY702106
Unique NameEY702106
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length870
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12504 contig Csv1_Contig12504:17..887. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Sweet orange fruit, development stadium (2 of 6)cdna_library
Properties
Property NameValue
Genbank descriptionCS00-C3-701-001-B06-CT.F Sweet orange fruit, development stadium (2 of 6) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY702106 ID=EY702106|Name=EY702106|organism=Citrus sinensis|type=EST|length=870bp
CTCAAGAAACTACGAACTAGTGGACGTTATATCTTTTGACTGTTGGAACC
CTAATTTCTTAATAAATTATTAGATTTTTAGGTTTTTTTCGTTTTGTTTC
TGTTTAATCCGAATGGCGGAGGAAGAGGTGTTGGCTCCGGCGTCTGCTGC
TGCGGCGGATCTTAAAAGGAAGCTCGACGATTTGGAGCCCGACGAGGCCT
TAGAACACGCAGAGGGAATGCGTGATGACGAGGCCAAGAACAGCGATGAA
GTGGAAAAGAACGTTGATGGATTTGCGGAGGCTCATGGATCAGAGGTTAA
GCGACCTAGACTTGATGATGATAAAACTGAAAAGCCTGATGGTCCAGTTA
ATGTGAATGGATTAAAAGAAGAGAAACCAGATGAAGTAGTGGATGCTGAA
CAGCCGACTGAGGATACTACTAAAGAAGAAGAGCAAGAAAGTGCGGAAGT
GAAAACTGAACAACATTCTTCAGTGGAAGAACAGGCTTCGGTTGACAATC
AGCAAATCTCTGTTAAAGAGGAGACAAAAGAAGTCTTAATCAGTACTGAA
GAGGCCTTTATTGATGTTAAAGAGGAAACCAAAGAAGTCACTGTTAAGGA
GGAAGAAACAGTTAAAGAAGAAGAATCAGTTGAACCCTCTAATGTGGTTC
CCCTCACAGTGGTTGACAATTCTAAGTCAGATGATCCGTCTTTCACTGAT
GATTCGACCATGAGCCACAAATTGAGGTCCCCTAACATAGGTTGGGGGTC
TTATTGGGCAGGCTGGGGATACATACNGTACTTTGCAGTACATTCGGGGG
CAAAAATTCAATTACTAGAGATGCTGATGCGGATCCCACGCTGNCACCAG
ACAGTAGAAATATAGGGACT
back to top