DR405956

Overview
NameDR405956
Unique NameDR405956
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length422
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248E17 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248E17 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR405956 ID=DR405956|Name=DR405956|organism=Citrus sinensis|type=EST|length=422bp
GGGGGCATAAAAAATTTGCCTTAGAGAAAGCAGAGAGCTCGGGTAATTTT
NNNNNTTTAAATTATAAAGCTCTTGTGAGTCTAGTGAGTGAGAGATTGGG
TGTATTGAGGTTCTGGGTAGTGAGCCAAAATATTATAATACTTGTAATTC
TCATATCACTAGTAAAATATTTTCCTTCTGTCTTCTCCCGTTAATGTAGG
CTAAAAGCCGAACCACGTAATTTCTTGGTGTCCTCTTTGTACTTGTTCTT
TATTTTTTCTTCCAATTCATTTTAACTGTGGTTCTGCTTTACCCACCAAA
TTCCTAACAATAATCCTAGTGCATTTTGTAAAGATAAAGTTGATGGAAAC
TTGGTTTTTGAGATTATCCAAATGATGTTTTTTTCTCTTAATTGAAAAAA
AAAAAAAAAAAAAAAAAAAAAA
back to top