DR405949

Overview
NameDR405949
Unique NameDR405949
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length554
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248E09 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248E09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR405949 ID=DR405949|Name=DR405949|organism=Citrus sinensis|type=EST|length=554bp
GCCGGGGGGGTAAAACTAGCTTATGGAGGTTNNNNGNNNNGATACTTTCA
AGGAAAGTTAAGCCAAGGCATGACACCCAAGAGAGTAATAGTACAGCCGG
CAGCAGCAATATTTTCCCGTGCCTACTCAAGCGGCTTCGAGGTGAAATCC
TCGAGTCCGTCCATGACTATGACCGCATGTTTAGCGGAGTTTGCTGAGCC
GGAGCCAGAGCTACAGCTAGGTGATTCGCGCAAAAACCTAAGGCGGCTAG
TGATCTATTGTTTCTCCAAAAAGGCCAAGGCGTTGTGTAATTAACAACTA
TATTTCTGGCTAAGGTTGGTGAAGAGACTATTTTGCCTCTGCAAATATGT
TCAGAAACGAAGGGATATGTTTAAAGCTCTTCCAATTCTTATAGATAGTT
TCTTGAAGCTTTCGATACAACCAAAGAAGGAACTTATTGCTTTTTACAAA
ATCAAAGGCTTTTCTTCAGCTATGTTCGATATGCCAAGCTCTGAATTAAT
GCCATTCTAAGTTCTAAGGTATCCCAAAAAAAAAAAAAAAAAAAAAAAAA
AAAA
back to top