DR404009

Overview
NameDR404009
Unique NameDR404009
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length675
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12121 contig Csv1_Contig12121:21..698. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246P22 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246P22 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR404009 ID=DR404009|Name=DR404009|organism=Citrus sinensis|type=EST|length=675bp
GGGGGATACAAGCATTAAACTTGAAAGCGTGAGGGGGAAAAAAAGAGAGA
AAAGAGTGAAAACATGAGTGGTAGAATTTGTATTGTGCCCTTGGCAATTT
TACTAATAGTGGTGGGATTATTTGCATCCGAGAATAAAGTTTTAGCTCAA
ATTTGCGGAATCAATAATCCTTCAGCTCTCCAAGCACAGTGTTTGAGGTT
TGTTAAAAAATCAGGGCCGATGCAGAAGCCAACTCGAGGCTGCTGCAAGG
AGGTGAAAGGAGTTGATGTAAGATGCGTGTGCAATCGTCTTTCGGATAAT
AATATTGCACAAATGGTGCTTAGTCGGATCAGCCTTCAAAAGACTGTTTC
CGTGGCCAGGTCTTGCGGCAAAAAACTTCCTTCAGGAAAAAAATGTGGAA
GTATAACCATTCCATGATTTGCATGATAATGGGAGAGGGGTGAAGCAGGA
GCTGCCGGACTTGCTATGAATTCTACTAATTAATATTTCAATTACTTAAT
AAGCCAGAATACGTGTTCTGAGCAGCTATAAGATCTTGTTGTATAATTTG
TTTCCATGCTTTCATATATGTACTAGAAATAACCACAATATTCTGAGCAG
CTATACGATCTTGTTGTATAATTTGTTTTCATGTTTTCATATATGTACCT
GGAAAATAAGCCCAATGTTTTAATT
back to top