DR404007

Overview
NameDR404007
Unique NameDR404007
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length410
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:5..414. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246P19 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246P19 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR404007 ID=DR404007|Name=DR404007|organism=Citrus sinensis|type=EST|length=410bp
GGGGGCTCAAGCACAGCTTCTTTTCTTTTGAGTTTTGAATACGGTTCAGT
CGAAGCCAGCAGAAATCTTTTGCCTTCCTGATTTGAAGATTATGGGAACT
CCTTGCGCAGGTTATACCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTT
TTCACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTAG
TCCCACAATATGGAAGAAACCCTGATCACACTGGTTAAGAATATGCAGTA
TTAGTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATT
ACCCGTCAATTGTACGATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGA
TCTCTTGATATATACAAGAGATTCTCTTTGTCAAAAAAAAAAAAAAAAAA
AAAAAAAAAA
back to top