DR404001

Overview
NameDR404001
Unique NameDR404001
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length487
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6383 contig Csv1_Contig6383:149..635. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246P12 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246P12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR404001 ID=DR404001|Name=DR404001|organism=Citrus sinensis|type=EST|length=487bp
GGGGAAGTACTTATTTTTTAGTATAGTGCACTCGAAGCTAGCAAATAACT
TTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAGCGAT
CCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGATGT
TGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGAAATC
CTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATATAATT
AAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGTCAAT
TTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTTTGTT
TGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTGTGTA
TCAATGTGTTGATTAAATTAGTCCATTAATAGATATAAAATCATTTGAAT
TTGTCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top