CX069512

Overview
NameCX069512
Unique NameCX069512
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length833
Alignments
Feature NameTypeLocationAnalysis
CX069512_ssr164 microsatellite CX069512_ssr164:164..175.
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS08_10H12_b Parent Washington Navel Orange Callus cDNA Library UCRCS08-2 Citrus sinensis cDNA clone UCRCS08-10H12-O24-1-5.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX069512 ID=CX069512|Name=CX069512|organism=Citrus sinensis|type=EST|length=833bp
CTCTTTGTCCCAAAAGGTTCTGAAAAATTGAGGACGTTAATGTCTATAGG
CCTATTGGAAAATTATTTTGCTTTGGTCAACTTACATAACAAGCATTTTT
TTTTCCCTGATGAAAATGTCGGAGCTTAGGTGGAATTATAAGTATCTTTG
ACGAGCAATCCTATAGTTAGTTAGTTATACATAATTGGAGGATCTGTCTA
TGGTACAGGTTCTGTAACAAACATCTCCCGTCATCCCACCATCCGATTGT
CTATTGTTTAGTTTCTCACTCCACATCCAACCACATCCAACGGCTGATGC
TGCTCTCTGTAGCTTACAGATTCTGTAAGCTAGTCAAGTCCATAATTGGA
ATATAAAATTTTTAATGACGTGACGTTTCATTTGTTACTCATCATCTTAC
ACTGGACAATCAATCATAGGTGACAGTGTGACACGCCATCTATATCTATA
AGAGCATCTCTAAAAGGATTTTTAAATTTTACTATTTAAATTTCAATTTG
TTTACTGATGTGGTAAATAAATGTATAAAAAAATATAATTCACTCCAAAA
GACTCACCAAATAAGAATAAATTAATATTATTTTAATCAAATCTTTTCCA
CTATCAAATTGAATTGTTATTAGATTTTTTAAAAGAAACATAAATAATAA
TTATTGCAGTTTTATCTTTTCAATAAATAATAATAAAATATTAATAGAAG
AGGGAGAAATTCACTTGACAATATTGAAGAGTGAGAAACAAATCTTATTT
GAAGAATCTAAATTAACGTGTCTTTTGGAGTGTTTAATATTGATATGGCT
TTTCAAATAAGAAGTAGAATCTTATTTGAAGAG
back to top