CX069497

Overview
NameCX069497
Unique NameCX069497
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length430
Alignments
Feature NameTypeLocationAnalysis
CX069497_ssr402 microsatellite CX069497_ssr402:402..416.
Csv1_Contig1323 contig Csv1_Contig1323:401..830. BLAST: Citrus Unigene V1 Contigs to SwissProt
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS08_10G12_b Parent Washington Navel Orange Callus cDNA Library UCRCS08-2 Citrus sinensis cDNA clone UCRCS08-10G12-M24-1-5.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX069497 ID=CX069497|Name=CX069497|organism=Citrus sinensis|type=EST|length=430bp
GCGAATTGGGGTACCGCGGCCCCCCCCTCGGAGACCCACCAAAGCACGAA
AGCCAGGATCTTTCAGAAAAAGGATTCCCATTCGAAGAGTGCATAACCGC
ATGGATAAGCTCACACTAACCCGTCAATTTGGGATCCAATTCGGGATTTT
CCTTGGGAGGTATCGGGAAGGAATTGGAATGGAATAATATCGATTCATAT
AGATACAGAAGAAAAAGTTCTCTATTGATTCAAATGCTGTACCTATGGGA
TAAGGATAGAGAAAGAGGAAAAAACCGAAGATTTCACATAGTACTTTTGA
TCGAAAAATCAATCCGATCTATTTCGTACCCTTCGCTCAACGAGAAAATG
GATCAGATTCTATAGGATCAACCCTATGGGACTTAAGGAATGATGGAAGG
GAATAAAATAAAATAAAAAAAAAAAAAAAA
back to top