CX069378

Overview
NameCX069378
Unique NameCX069378
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length347
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6931 contig Csv1_Contig6931:1567..1913. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS08_10A12_g Parent Washington Navel Orange Callus cDNA Library UCRCS08-2 Citrus sinensis cDNA clone UCRCS08-10A12-A24-1-4.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX069378 ID=CX069378|Name=CX069378|organism=Citrus sinensis|type=EST|length=347bp
GTAACATTGATGAGACTCTTTATTATAATTATGAGTTTATAAGTTATTAG
TTAGTTTCTTGCCTCGCTCTCGGCAGGTCAACATTAGGTCGATAATAATT
TTGAGGGCGTATCTAGAACTTATGGTTGTGGCAGAGATATGCAATTGTGT
TTCTGTATTGAATTTGTTTCGATGTTTTTGGTTGCTGATCTTTCTTTGAA
ACTCGATGGGTGGGAACACATGCAATGGCCTTAAGGTATGATATGTTATA
TGCCTACTCTTGATCTAGTTGCCACTAGATTATGCTATATTGAACCTCTT
AAATGTTATAAGTTATGCACTCTTATTATTATGTAATGTTATTTTTT
back to top