DR403415

Overview
NameDR403415
Unique NameDR403415
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length738
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9599 contig Csv1_Contig9599:9..746. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P08 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403415 ID=DR403415|Name=DR403415|organism=Citrus sinensis|type=EST|length=738bp
GGGGACAGCCTGAAATTTTTATCATTTCTAGTGACACGATCGTTGAATCT
CTAACCGACTCTCGAAAATGCCTCGCAGAAGCTCCGGAGGAGGAAGGTCT
GCTCCCCGCCCTCGTCCCGCTGCTGGTTCCCCATTGCGCAATCCTCCTCA
GCCAGCCGCACATGCTCCTCCACCAGCACCTTTGCAAGGTGGGAATAGAT
CTGTGACAGGAGGAGGTCTTGGCGCTGCTGTAGCGGATGGCCTGGCCTTT
GGTACTGGCAGCGCGGTAGCTCACAGGGCTGTTGATGCTGTGATAGGCCC
TCGTGTGATCCACCATGAGAGTGTTGCTTCATCAGCCCCTGCAGCCGCAC
CAGCACCTAACTCAAGTAGCCTTGGGGGTGCTGATGCATGTGCTGGTCAA
ATTAAGGCCATTCAAGATTGCCTAAATAACTATGGAAGTGACATCGGCAA
GTGCCAATTTTACATGAATATGCTTCAAGAATGTCGCAGGAGTTCTATGG
CTGGCAGGAGTGCTTGATGTTTGATTCTGGCGAAGAGAAGATTGAATCTG
TAACCTTTGCAAACTATTATGGCTACATTTTATTCTGGATAAAGGGATCT
TATGTTTTGCGGTGGAACTTTGTAGCTAGCTTAATGTTATCTGTCACTTT
TGCAAACCAGTTAAAAGTGATGGAATCTGAAGTTAGCAGTGGAACTCTGT
GGCTATAGCTAAATGTTTGTGTAAACGCTGTATGATGC
back to top