DR403409

Overview
NameDR403409
Unique NameDR403409
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length408
Alignments
Feature NameTypeLocationAnalysis
DR403409_ssr193 microsatellite DR403409_ssr193:193..204.
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244O18 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244O18 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403409 ID=DR403409|Name=DR403409|organism=Citrus sinensis|type=EST|length=408bp
GGGGATTGACAAAAGCTTTTTTGTTTTTTGAATTTCTTTGAGAATTTTTA
ATGAAACGACAATTAGTGACTGCCGTTTAGAATTCTTATCGTTGGAGATA
ACAACATAACAGATAGGCCAAAAAGCCAAAACAGAAGTGCAGGGCAAAAG
ATATGATTACTTCTTGTCGAAAGTCCAGAGGAGAGACAGAAGACAAACAA
ACAACAATACGAGGTTACGTTTCGAGTCCCTTGCCGTTTTGAACTCTGTT
TGGAATTTAATGTTATAAAAATGTTTTCTTAAATTTAGTATCCGACCCTA
TGTGATCGGGTGATCCGGGTCAAGTATCGGAGATAATCCGCTCGGGTTTT
TCCACCGGATGATATTTCAAATTTTTATTTTTTCAACTCAAAAAAAAAAA
AAAAAAAA
back to top