CX046746

Overview
NameCX046746
Unique NameCX046746
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length779
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_9H12_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H12-P23-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046746 ID=CX046746|Name=CX046746|organism=Citrus sinensis|type=EST|length=779bp
TTCTGAGGCACCGCTAACCAATCCTCGGTGTCTCCGCCCTCTCGTTTCTC
TCTGCGTCGAGTAGAACAAAACGATCCGGAGCTCTTTCAAGTCCTCCTAC
GGCGTCGTTTTGCCCCGTCGATCACAATGTCGGCGATTTCAAACTTTGCC
GCGTCTCCGTTGAGCCAGGGCGCCGTCCATTTCCCCGACAGGAAGCTAAA
ATTCGAGTCCGTTTTCGGTGTAAATTTGAGAATTTCGAGATCTTACGAGA
ATGATGCATTACGTGTCTCTCGGTTAGCTCTTGGTCAATCAAGCAGTGTT
GCTAAACGTATAAATGTACGTATGGCATTAGTAGATGAGAGGCTTGCTCG
AGTTGGCAAAGATGTGGCTGAGCCTTCTGGAGTCTTGGCGTATGATCTTA
TTCAAGGAACACTTGTAAGATGGAGCTCAATGATGGACAAATCAATACCG
GATCCACCAACAGCTGTTCTCTTGCACGGCATTCTTGGGAGTAGGAAAAA
CTGGGGAACTTTTGCCCGAAGACTGGCTCGAGCATATCCGACGTGGCAGT
TTCTCCTAGTAGACCTGCGATGTCATGGTGATTCCACATCAATCAAGAAA
AGGGGGCCTCACACTGTTGCCTCAACCGCCCTTGATGTCTTGAAACTGGT
TGCTCAACTTAGAATAACACCCAGAGTTTTAGTTGGTCACAGCTTTGGAG
GAAAAGTTGTCTTGAGCATGGTGGAACAAGCTGCCAAACCTCTTGCACGC
CCAGTCAGAGTATGGGTTTTGGATGCTAC
back to top