CX046744

Overview
NameCX046744
Unique NameCX046744
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length423
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:688..1110. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_9H11_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H11-P21-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046744 ID=CX046744|Name=CX046744|organism=Citrus sinensis|type=EST|length=423bp
CAACGATAACGCTTCATTAGGAAAGCAGTTTATAACAATCGGTGAAGGTA
AAACGTGTCAAAATTTTTTTAAACTTGAGAAAGTTAGTGCATCAATATTT
GATATGAAAATAGCACTAGACATTCCCTGTCTATACAAAATTGTTCATTG
TTCAACACTTGTTAATGGTTCTTGCGATACACTCTGCAAAGACGTTGGCG
TTTCTAATGTGGATGGCGTCCAACGTCTAGTTGTGGTTGATGATAATGAT
CAGCCAAATCTGCCTTTGCCTGTTGTGTTATTTCCAGCTGATAGTGGAAG
ATCTATGTTATTTCCGTCTCTGTAATGAATAAGCCAACAGGCTGTATTAT
TCTAAATAATGGACCAGGCTAGTACTCTTTAATCTCTATGGTTAAGCATA
AATAAAATAGCCTATGATGCTTT
back to top