DN135092

Overview
NameDN135092
Unique NameDN135092
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length314
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionwca06b03 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca06b03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135092 ID=DN135092|Name=DN135092|organism=Citrus sinensis|type=EST|length=314bp
TTTTTTTTTTTTTTTTTGGGTAATGGACGCTAATATGTACTTACAAGCTA
TGGGTCTGAAAAATATTATAGCAAAAGGAAACGAAGCATCTTTACAGGAA
AAATCAAAGGCCATGATTTTCCTCCGCCCCCATATACATAAAAGCCTGAA
AGCTCACTATCAAAAGATGGAGGATCCAGTAACTTTGTAGAGTAATCTCA
AGAAAATGTTTAACCACTAAATGAATATTTTCTCCCAAATGCCGAACATG
AGTGGTTAAACTTGAAATTCTATGATTAGGTAAAAAAAAAAAAAAAAAAA
AAAAAAAAAACATG
back to top