DN135086

Overview
NameDN135086
Unique NameDN135086
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length385
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionwca06a02 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca06a02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135086 ID=DN135086|Name=DN135086|organism=Citrus sinensis|type=EST|length=385bp
TTTTGAAAAGAAGCCNNNNCACCACTAGGATATTTGTTGGCTTATTTCAT
CCAGATATTTCTCAGAACTATTGTTTACCTCAGTTCTCACTTTTTCCTGT
CTCACCAAAAGGTTCAATTGAACAACCAACTGTTATTTCTTTAGATATTA
ATGATCAAACTTCTTTTTGTAATTGTTGAAAGCCTGGATACCGCAAATTC
AGCCTTTCTGGTTATTTCTGCTTGTCAAACTCCTGTGCAAATAAGGCTTA
TGAATGATTTGGATTATCTATCACTTTGAAAAATAAATGTCATGGAGTTA
TCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top