DN134769

Overview
NameDN134769
Unique NameDN134769
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length568
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
DN134769_ssr17 microsatellite DN134769_ssr17:17..38.
Properties
Property NameValue
Genbank descriptionwca01a12 Developing fruit albedo at 80 DAFB in Vulnus5 vector Citrus sinensis cDNA clone wca01a12 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN134769 ID=DN134769|Name=DN134769|organism=Citrus sinensis|type=EST|length=568bp
GTGAGAGNCCCGTGAAAGAGAGAGAGAGAGAGAGAGAGGAATTTTGACCC
GTTGACCCGAAAACCCGACCCGGACCCGCGATATTGACCCAAACGGATCT
CCTAATTCCGGCCACCTTACCGGTCGTGCTTGGTACCGATCTGAAGCATG
GAAGCCGACCGTCGTATCCCCGTGGTCCTCGTCGCCGAAAACCGACCAGA
ACGCCGACGATTTGAGCTCGAAAGTCGCGGCCAAGATCCTTTTCCGTCGC
CGTTGATTCCGCTGGGTTTGTGACGCGCCACCACTTGGAACTGGTTCCTC
ACATCTCCAGCAACAATTTCTGACCAACCACGACCACCAGGGACGCTGGA
AAATCGTCGAACGACCACCGGAAAGTTTCGGATTTTTTTTGGAGCTTCGA
TCCGCCGTTGCCGCCGCGCGTGGGAGGACACCGCCGGCACCATTGCACTC
ACCGAGGTCGGAACTAGCTGACCTAAGCTCCCCGTCGTCGTTGACTGAAG
TCCGGTCACCGTTGACCGGCAGGGGCAATTCNNCAAATTCCTGAAACTTT
GGGGTGAATTTGNNNTTT
back to top