DN134766

Overview
NameDN134766
Unique NameDN134766
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length709
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in Vulnus5 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9629 contig Csv1_Contig9629:208..916. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca01a09 Developing fruit albedo at 80 DAFB in Vulnus5 vector Citrus sinensis cDNA clone wca01a09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN134766 ID=DN134766|Name=DN134766|organism=Citrus sinensis|type=EST|length=709bp
GGTTGAGAAGTGTGCACACCGGGATCAGTAGCTAAGAAAGCAGCCTACTT
TGAAGCTCATTACAAGAAGATTGCTGCAAGAAAGGCTGAGCTGCTGGATC
AGGAGAAGCAAATGGACAATGATTCCTCAAGGTTAGATAATCAAACTTGT
GGAGATCTGATGGCAGACAATTGCAAGAACAAATCAAAATCTGATATATC
TGATCATCAAAGGTCTGATGATATAGTTTACCCAGAAACCAGCTTGGTTA
ATGAAGTGAGGGGAATGCCTGTTGATCAGCCTGGTGGGGATGCTGCAATT
AAAGTGGAGTGTCAAAGCTCGCCAGTTGAGAGAGTGAAAGAGGAGAAAAG
CAGATTAGAAAGTCCGACATCAAACAAACCAGAAGAAGCTGTGGTTGTTA
CAGTGAAAGAAGATGTGGAAAATAGTTCCATGCGGATGGTCATTGTAAAG
GAGTTACAGGAAAAGGAAATGGAACCTGCTACAAATGTTAAAGAAGAAAA
CGTGAAGTTGGATCATCCAAAGAATTCTCATAAGATTGCACCGGTGAATA
AGGAGAAAAACATTTCTAAGATAAAGAAGAAACCAGCATCACCTGCTGCA
AAGTCCTCACCTATAACTAAGGCATCAAGAATAGCTAAGTCACCGCATCT
TTCAACCCCCAAAGTGTCNNAGCCAACCCCTATGTCTACTCTATCTTCAT
CAAGATCTT
back to top