DN134764

Overview
NameDN134764
Unique NameDN134764
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length558
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11045 contig Csv1_Contig11045:1..550. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca01a04 Developing fruit albedo at 80 DAFB in Vulnus5 vector Citrus sinensis cDNA clone wca01a04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN134764 ID=DN134764|Name=DN134764|organism=Citrus sinensis|type=EST|length=558bp
CGGCCGGGGANNTCNACACTCAAGCGCATTGTCAATTTCTTTGCTTTCTT
ATATTTATATACTTGTTTTCTTTGTAGTTTTCTAGCTGTTGAAATTGCAA
TATGGCCACAGTTGAGGTTGTGTCAGCAAAGACTGCTCTTTCCGAGGAGA
TCAAAGCTGAGGAGCCAGTCAAGGCTGAAGAAACTAAAACAGCTGAGGAG
CCAGTCAAGGCTGAAGAAACTAAAACAGCTGATGAACCAGTCAAGACTGA
AGAAACTAAAACAGAGGAGGTAGTTGCTTCAGCTTCTGCAGCACCTGTGG
CACCAGAACCCGTTGCTGAAGAGCCACCAGCAGCAAAGGAAGCAAAAGCT
GTTGCTGTAACTGAAGAAGCAGCGGTGGTTACTCCAGAAGCTGAAGCCCC
AGCTGAAGTTGAGACAAAGGAGGTGGTAGCCGAAGATCAGCCAGCAGCAG
CGGAGAAGACTACCGCAGAGAAAACTGAAGAAGTGGAAACTACTCCAACG
GAGACACCAGAGCCAGCTGCTGAGAAAGAGGCCAAGGAAGGAGAGAAGAA
GCCAGAGG
back to top