DC900440

Overview
NameDC900440
Unique NameDC900440
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length207
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900440 VSS Citrus sinensis cDNA clone VSSH011 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900440 ID=DC900440|Name=DC900440|organism=Citrus sinensis|type=EST|length=207bp
GGCACGAGGAAACAAGAAAAAAAAAATAGCCATACTGTATTAAAAAAGAA
AAAAGAAAAAGATATGGNTTCTATTAACACTCGTTTGGTCTTGGCCATGG
CGGTAATTNTNGGAACCCTAATCTNCGACAATTTACAGGTCGCGGCGCAA
TNTGGAGGAAGCATTCCTCAACTCATTGCTCAGTGCTCGNAATTCGTCAA
GATCGAG
back to top