DC900439

Overview
NameDC900439
Unique NameDC900439
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length201
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900439 VSS Citrus sinensis cDNA clone VSSH008 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900439 ID=DC900439|Name=DC900439|organism=Citrus sinensis|type=EST|length=201bp
GGCACGAGCAGATTCATCGAGCAAATGTNTCGGGACACAGAAGTACCAAC
ATTATGCNTTCAGTGCGTAAAATCCGACCCCGCTGGCGAAAAAGCCGATA
AGTCAACCGATATTGCCGCCATAGCCATAAAATGCCTGAGCAACCACGCT
GAAGCTTTGGTAAAAAACATGTCATCTTTGGCTTCAACGTACTCCTCTGA
T
back to top