DC900438

Overview
NameDC900438
Unique NameDC900438
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length248
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900438 VSS Citrus sinensis cDNA clone VSSG039 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900438 ID=DC900438|Name=DC900438|organism=Citrus sinensis|type=EST|length=248bp
GGCACGAGCCGCCAGGAGGTATAGAACCACCATATGTCGAAGAGGCATTA
CTTGCTTCCCAAGAAATTTCAGCATCGTACTCCGAAAAGGAAGTNTCCCC
TGCTGAAGCGCCTAGTCCTAGCCCTGAAGAGCCAATTATCAATATCAGGG
CGTCCCCTGTGGAAGCTCCGGGGCCTAGNTCTACAAAGGATGAAAAATAT
CCCTTTTCGCATAAAGAATCTCCGGAGAAATGTCTCTTCCATATGAAG
back to top