DC900436

Overview
NameDC900436
Unique NameDC900436
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length260
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900436 VSS Citrus sinensis cDNA clone VSSG027 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900436 ID=DC900436|Name=DC900436|organism=Citrus sinensis|type=EST|length=260bp
GGCACGAGATTTTCCTCTCCTAGTACTGTTTTTNTNAGTCTTCACGTCCG
CTACAGGTACGGTGCTGGGAAACGTTCATCCTTGTGGGAAGCCTTTNNTC
CACATCATTAATTGCTCAAAGCTGGCCTGTNTTCAGAGCTGTNTTCAAAA
ATATAATGAAAGTATAAACGGTGCATGCATCGACATGGACAATTGTTGCT
GCAATGTACTAATATTAGGATGACTTGCTTTCTGCTCATCTCGGATTTNT
TCAACATAAT
back to top