DC900435

Overview
NameDC900435
Unique NameDC900435
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length248
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900435_ssr179 microsatellite DC900435_ssr179:179..190.
Csv1_Contig6375 contig Csv1_Contig6375:343..590. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900435 VSS Citrus sinensis cDNA clone VSSG024 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900435 ID=DC900435|Name=DC900435|organism=Citrus sinensis|type=EST|length=248bp
GGCACGAGCTCCTGCAAAATTTCAGGCGCTCCATCTCCGGGNTCATCGGT
GCCACCTCCAGGAACCCCGGGGAATGATAACGGTGCAACAGCGAGGGAAG
CGTGGGCTGGAATCACTAGCTTACTCCTATTCTGGGCTGCTTCAATGATG
CTTTACTAGGACTATTAATATATTACGGTATTATTATTATTGTAGTAATT
TATGTTGGGTTCATTCGAGTTGTTGGAGGAGTAAATAACATTGAGATC
back to top