DC900429

Overview
NameDC900429
Unique NameDC900429
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length208
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900429 VSS Citrus sinensis cDNA clone VSSG012 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900429 ID=DC900429|Name=DC900429|organism=Citrus sinensis|type=EST|length=208bp
TCGAGCTGTGTTGTACGATCAAGGCGTCATCGNTCAGCGTTCCTCTTAGT
CTCACATATTATCGGCGCCNTCATTCAGCTCGAAGCCTGAAACCNCTNAT
TCCTACTGTCATTATCCGACCTACCTANTCGGACCGTGTTGTAAATTTAC
GAATGCATAGCCGCGNCTATTNNGCACNTTCTTATGGGTGGGNACTTCAG
CAAGCGTT
back to top