DC900428

Overview
NameDC900428
Unique NameDC900428
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length176
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900428 VSS Citrus sinensis cDNA clone VSSG010 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900428 ID=DC900428|Name=DC900428|organism=Citrus sinensis|type=EST|length=176bp
GGCAGGGTGTTTACCCATCCNTCCATGGGCCTGTACACCCACATGCAAGT
ATGAGTTGTTCACAGTATTCNGGAAGGCAGTAGNTTGTGTTTTCGAGGAA
CGTGCATNCGTCCAATGTGTGTTNTCTAAGGCGANTAGACCAAATCCAAA
ACNTAAGTTNGGAACAACCAAATGCC
back to top