DC900427

Overview
NameDC900427
Unique NameDC900427
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length142
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900427 VSS Citrus sinensis cDNA clone VSSG005 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900427 ID=DC900427|Name=DC900427|organism=Citrus sinensis|type=EST|length=142bp
GGCAGAGAGAAGATTTAGGTTTCAATAGCCGGTTCAGTACTCCGATCAAG
CNACTTTCATAGTNTAGATTAAGTAGCTGGCACTATGCCAGGTTATGTTA
NTTCCTATATTGTTCACTGTGAGTGTAGTGTACAAACGGGGT
back to top