DC900426

Overview
NameDC900426
Unique NameDC900426
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length260
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900426_ssr226 microsatellite DC900426_ssr226:226..237.
Csv1_Contig224 contig Csv1_Contig224:1..231. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900426 VSS Citrus sinensis cDNA clone VSSG002 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900426 ID=DC900426|Name=DC900426|organism=Citrus sinensis|type=EST|length=260bp
GGCACGAGTCTCAATCTCATTTCCTCATCGCACTCCCAAAAAAACTACTC
ACAAAAATGAACTCCTTCGCTAGCTCTGTNTTTGTCATCTTGCTCATCAC
ATCAACTTCGTCACTTTGCGTGGCTGCCCGACCCGGAGCATCAGCTGAGC
TCAACAACGACGACAAGCTCTCTGAAGGCAAAACCACCAACCAAAACACC
AAGGGTGGAAACGGGTATGACGCCGGGATGGATGGATTCTTTGGACCCGG
ATCAGGTATA
back to top