DC900425

Overview
NameDC900425
Unique NameDC900425
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length165
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900425 VSS Citrus sinensis cDNA clone VSSF006 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900425 ID=DC900425|Name=DC900425|organism=Citrus sinensis|type=EST|length=165bp
GGCACGAGGACACAGACAATACTTCGATTCCTGTAACAAAATCAATCTGA
GAGCATTCAGCAGCTCGNTTTGCCAATTCATTTCGCAGTTTATGAATTGG
AAAACTTATGGGTTTGGNATCGGNTAGCACTGCTACTGATGGTATGCAAT
TNTGCATATTTGACT
back to top