DC900420

Overview
NameDC900420
Unique NameDC900420
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length285
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900420 VSS Citrus sinensis cDNA clone VSSB008 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900420 ID=DC900420|Name=DC900420|organism=Citrus sinensis|type=EST|length=285bp
GGCAGAGGGACGACAGGTTGAGTATTTGGAGAGATTATCAGGTTCGCTTA
CTGCATGGTGGGGATCCTATGNTCTCGTGTNGAGCACCTCANTTGNGCGG
GCGCCAAGGTTGCCGTTNTGTCTCTGGTANGAGCTCTGCATGAGGATGTA
TGCTTACATTANTGTCTNTAAATCCGCAAAGACTTCAATTTGCNAGCGGG
GGTTAGGAGCTACGTTANTAGGTCTNGAGTCTAGATGGTTTTTGTGACCC
TAAAATGTCGATCGCACATGTNATAGTCTATTGAG
back to top