DC900417

Overview
NameDC900417
Unique NameDC900417
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length140
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900417 VSS Citrus sinensis cDNA clone VSSB001 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900417 ID=DC900417|Name=DC900417|organism=Citrus sinensis|type=EST|length=140bp
GGCAGGCGGTCACTGGAGCAGGCGCGATGAAGTGGCCGTAAGCTAGGGAG
TGGGGCAGGTGGATTTGGGANACAATCNTGGTCGACAGGTCTAACTNGTG
TATCATTATAGGGTTTTNGTGTANGTTGGTAGTCAACGCT
back to top