DC900415

Overview
NameDC900415
Unique NameDC900415
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length808
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionDC900415 VSS Citrus sinensis cDNA clone VS28996 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900415 ID=DC900415|Name=DC900415|organism=Citrus sinensis|type=EST|length=808bp
CTTTCAAAAGCAGTTTCTATCTTCCATGATCGTTTTGATCCGATAATTGA
AAGTGCATCTAAACTTGACCTCATTCCTGCAATGGTTTATGGGAGAAGCC
ATAGGGGCCAAGATTATCATGGGATGTATTGTGCCATATTGACAGTAAAC
CAAGTGGTCGTGTCTGCCGGAATTTTTAGGATTTTTGGGCAAGAACTGGC
AGAGCTTCCTTTAGTTGCAACTAGTAATGATTGCCAAGGCCAGGGTTACT
TCCAGAGCCTTTTCTGTTGTATTGAGAAGCTACTCGGCTTCTTAAACGTG
AAGACACTGGTCCTTCCATCAGCCAGTGAAGCGCAAGCAATTTGGACTAA
TAAATTTGGTTTCAGCATGATGACCGAGGAAGAGCAAAACAAGTACAGAA
ATGACTATCCCCTGATGATCTTCCAAGGAACATCAATGCTGCAGAAGCCG
GTCCCAAAATGCCGGATTGTCGGTAAATCAGTGGATGGCTAAATGTAAAT
CAGTTGGTTTTTGCTTACCCCTTTTGCAAGAAAATGTACAGGTTTTCTTT
GTCAGTTCCTTGTACAGAGATTAGAAGAAATCAGCCGTAATGCTTTTTTT
TCCCCCACCTTTTGGGTTAATTTATATTTGGGACATCTGGGGCTGGCTTA
CTAAAAAGAATGAAGAAGAAAGATAGCGAACAACTTAGCATATACAAAAT
TTTGGGGGCGTTTCAGTTTAATGAGGGGAATTTTCCCAATTTTGAAAACC
TTTGTATTTGGTCCATCTTGGAAACTGTTAGTTGAATANAAAAATGCAGT
TTCTTCTG
back to top