DC900414

Overview
NameDC900414
Unique NameDC900414
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length271
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900414 VSS Citrus sinensis cDNA clone VS28994 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900414 ID=DC900414|Name=DC900414|organism=Citrus sinensis|type=EST|length=271bp
GGAGGACGTAGTTGTCGCTGATCCAACCGTCGAGATGGAAGGAAAATTTC
GGGATATGTCAATCGACGGCGGAAGCGACAAGTCTGCGAGGCCACAATCA
AATAAAGGGGGGATTTTTCATCGCGGTAAGTACACTAACCACCTCCGTGA
TCGTGGAGGGCGAGAGGCAAAATATGCGAGGGGGATGATGGTTTGGGTGA
AGAAAGGAGACAGTGTTGGTGGGGCCGGAGCTCCAGCTGATGCCTGATCA
GTGATCAGAACTACTCTTTTT
back to top