DC900397

Overview
NameDC900397
Unique NameDC900397
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length694
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10246 contig Csv1_Contig10246:116..809. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900397 VSS Citrus sinensis cDNA clone VS28971 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900397 ID=DC900397|Name=DC900397|organism=Citrus sinensis|type=EST|length=694bp
AGAGACTGAAGATGTGGAGGAGCAGCCTCTTGTTAGGCACAGGTCCATAC
ATACGTCTTCGGGTTCTGGGGAATCTGACAAGGAAGTTGGGGTTACTGAG
GTCAGCCCACCTCCAAGTCCTGGACAGCCTGATGTCAGCAATCAACCACA
GCACAACGGAAATGCATTTCCTTCAGATGAGTGGGGTGGCATCTCTTCCG
AGGAGCATGATGAAGCAGTTATGCTTGAGGCTGCAATGTTTGGTGGAATA
CCTGAAAGTGGATACCGTTTTCCGTATGCACCTCATCAGTACATGCAACC
TGAGGGCTCTTATCCTCGGCGAGTACCTCGTCCTCCATCACCCTCATTGG
AAGCTCAGCGCCTGATACGGGAGCAGCAGGATGATGAATATCTTGCATCA
TTGCAAGCAGACAGAGAAAAAGCTGAAGCTCGCCGTCTAATGGAGGAAGA
AGCAAGAAATGCTGCTCTTGCTGAGGAAAGAAGAAAAGAGGAAGAAACCC
GTCGGAAAATGGAGGAGCAGCAGGAATATGAAAGACAATTAGCAGCAAAA
GAAGCGTCATTGCCTCAGGAGCCAGCCCCAGATGATGAAAATGCTGTGAC
CCTTCTGGTGCGGATGCCAGATGGCAGTCGTCGTGGTCGCCGATTCCTTA
AGTCCAACAAGCTGCAGTCTCTTTTTGACTATATAGATGTTGGA
back to top