DC900393

Overview
NameDC900393
Unique NameDC900393
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length448
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900393_ssr10 microsatellite DC900393_ssr10:10..43.
DC900393_ssr388 microsatellite DC900393_ssr388:388..399.
Properties
Property NameValue
Genbank descriptionDC900393 VSS Citrus sinensis cDNA clone VS28966 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900393 ID=DC900393|Name=DC900393|organism=Citrus sinensis|type=EST|length=448bp
CTCGTGCCGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTCGTG
CCGAATTCGGCACGAGAAGACGGAAGGCCCAAGTATCCACGGCGATGGGT
AATACTGCCCCCATTCCTGTAGAAGTGATTGGCGAGCCTGCCGCTCGTTG
GTTAAGTTTTGGATTCAACTTCTTGTATTGAAGACTATCAGTCCATTCTC
TTCAGATATGAACTAGAGCTCACATGTTCACCTAGTTTCATTATTGGTGT
TTAGACAGTTTAGACGTTGTAATTCATTTGAGCTGTGCGAGCATATTTTC
TTTTATCTAAATCAAATCACTTAGCAAGTGTTTGGACTTGTCTTAGTTTC
GTTGCATGTTCGTGGCTAATCTTTCATATGTTGTTGCTTCTTTCTTTCTT
TTTTAGCAAGTAATGTGTAATCTAGTGGCCTTTTGGCACAATGAAGTC
back to top