DC900392

Overview
NameDC900392
Unique NameDC900392
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length366
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900392 VSS Citrus sinensis cDNA clone VS28965 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900392 ID=DC900392|Name=DC900392|organism=Citrus sinensis|type=EST|length=366bp
CGAAGATCTTGTAAGTGAGTTATGCAGTGATGAGGATCTTGCAGAGGAAT
ATGCGGAGATTTTACGGAGTGACATATACCAACGACTTAAGGGTGACTCA
GGGCGTGACTGCTAACTTCTTACCTGCATGTAAGCAATAGTTTCAATGTG
TCATAGACGGTGCTTCTGCCGGTTCACAGAAAGACCTTGTACAAGTTAGG
TTTGGGCATGGTGAGTTAAAAGTTGATCTTAATGTTTCCAGTGCGAAGCT
GCGTGTATGTATCCACACACATTTTCTGTTACATTTTGTATAAATTATCA
ATAGTTTCATACATTTCATAACTTTTAAAATATTTCAGTCGAATTTTTTT
TTTTTGGTTGGGGGGT
back to top