DC900389

Overview
NameDC900389
Unique NameDC900389
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length257
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13832 contig Csv1_Contig13832:234..493. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900389 VSS Citrus sinensis cDNA clone VS28962 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900389 ID=DC900389|Name=DC900389|organism=Citrus sinensis|type=EST|length=257bp
AGAGAGAGAACTAGTCTCGAGTTTCTATGGAAGTTCATCGGTTTCATGTT
ATTCAATAAAAAGGAAACGGTTTGAACACATGGTTGAATTTTTTTCCCAG
ATATTTTTATTGCCCTTTCTTCTTTTGAGCTTCTATTGAAAAAAAAAAAA
ACAAAATTGCTCTTCATTTTTAGCCTATTTGTTTGACTTGTAATGAGAAA
ACAGCTGAATCTGTATGAATTTATAAGCATGTGGGATTTGACCCCATTTT
GACTCAA
back to top