DC900383

Overview
NameDC900383
Unique NameDC900383
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length303
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900383_ssr211 microsatellite DC900383_ssr211:211..222.
Properties
Property NameValue
Genbank descriptionDC900383 VSS Citrus sinensis cDNA clone VS28957 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900383 ID=DC900383|Name=DC900383|organism=Citrus sinensis|type=EST|length=303bp
TACGGTTCACTAGAAGCTTTGAAGAATATGGAATCTCTTTGCGAAGGTAA
GAATGATTGGTCGGAGGGTCTCCAATTTCCACCATGTGGCAGTATCGTTC
ATGATGAGATTGTGAATGAAAGTCTTGATCTTCTTGTTCCTCCACAACAT
GGAAGAAATTCCAACCACACTGGTTAAGTGCATGAAATGTCACTTTTTTT
ATATTATGNTTAAATAAATAAAATGGTGGATACTGNTATTAAATCTCTTG
AGATATTCAAGAGATTTTATTTGGTTATTTACATGTACCGGGGTTTCCTA
AAA
back to top