DC900375

Overview
NameDC900375
Unique NameDC900375
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length772
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900375_ssr360 microsatellite DC900375_ssr360:360..371.
Properties
Property NameValue
Genbank descriptionDC900375 VSS Citrus sinensis cDNA clone VS28945 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900375 ID=DC900375|Name=DC900375|organism=Citrus sinensis|type=EST|length=772bp
CTTCTTTTTAACTCCTGGTTTCATAGTTGTGTTCGCGAGTCTTTTTATTT
TAAGTTTCGATTTCATTGTTCTTTCATAAAATAAAAAAATAAAAAAGAAA
AACAAGGAAAATTGATTTCCATGTAATATATGAAAATGAGGAAAGTTAAT
GCAAAGGTGATGATTAATTTCATTTGATCAAAACCTATTCGCTACGTTCT
TTCTGATTCATTTTTTCTGTTTTTTTTTTCTTTTTTAAATAGTTTTCAGT
GAAATTACATCATCAAGATGATGAAATCAGAAAAAATCTTAGGACACCTT
CTGACACAGTGAAACCTACTGTGTATGAGAATGATTCAGTTAATCAGTTC
TGATACTTGATGTATGTATGTTTGCTTTCTCCAGCACATTTTATTTTATT
TATTGATTTTTTTGTTATTTGTTGATATTTCTTTTTAGATTTTGTTTCTG
GTTTTTTTTTCAAGTTTAAAAAAATCCTACAGCCGTGTACCATACGAATC
AAGGGGAGAACACGAGTTCTGCATTGGGGTCTCAGTGATAGTAGCACACC
AATTGTTTGACAAAATGCCGCAACGGGTGATGCCACCATTAAGTTATCAA
CTCCTGGATGCCTTTGCTGAATATAATAATAATGCCGGAGCTTAGTAAAA
TTTGTGATGATGAAACCTGTGGGAGCTAAAATTTAAAAAAGTGGTTACAA
GCAACTATGATTTAGTTGAACAACTAGACATTAACTCAAAGACTCGATAC
GAATAAAAGCGATATTCAATTC
back to top