DC900368

Overview
NameDC900368
Unique NameDC900368
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length625
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7307 contig Csv1_Contig7307:25..650. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900368 VSS Citrus sinensis cDNA clone VS28938 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900368 ID=DC900368|Name=DC900368|organism=Citrus sinensis|type=EST|length=625bp
TGCCAAACCAACCCAACTACAGACCCGAAAAAACCCGACCCGACCTGCGA
ACGTGACCCGGCCATATCTCCCATTTCCGGCCACCGTTTTGGCCGAGCTT
GGTACCAATCTGAAGCTTAGAAGCCGACCGTCGTTCCCATGCCATCCTCT
CCGCCGAAAACCAACCGGAACACCGGAGACCGAAGCTTGAAACCCGCGAC
TGTTTCACTTTACTCCGCCGGGATTTTCGCCGGTTTTGGGTGATACCACC
AGTTGGATTTTGTTCCCCACGATTCCCTCTTCCATTTCCGACCATTCATA
GGCACCGAGAGTCACTGTTTTGCCGCCGGTCGATTCTTGGAATTCACGGC
TGCCGAGCTAGATTCCGGCGTCGTTGCCGCGCGTTGGAGCTCACCGTCGG
TACCATTGAACTCAGCGTGATTGGAACTTTAAGATTTGAGCTTCCTAGCC
AGTGTTGACCAAATTCCGGTGACCGTTGATCGGCAAGGGCATTTTGGAGG
ATTTGCGAGCGAGAATCGGTCCGCGGACGTGGACGATAACCGACCGNGAA
CACCGTCACTGAGGNTGCAGGTACACCAGACCGACCCAGCGACTGTAATA
TATTTTGAGTCTTGGCCACGTGATG
back to top