DC900367

Overview
NameDC900367
Unique NameDC900367
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length338
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2169 contig Csv1_Contig2169:1393..1730. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900367 VSS Citrus sinensis cDNA clone VS28935 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900367 ID=DC900367|Name=DC900367|organism=Citrus sinensis|type=EST|length=338bp
GAAGGATCCCACAGGTGCGAAGGTCACCAAGTCCGCAGCCAAGAAGAAAT
GAGAAATTTTTATGGGTCTGTCTACAATAGTTAGGGTTTATTTTCTGTCT
TTTTTTATTTTCTTGTCTGTTTTTGTTTTGCATCAATGTTTCTGCAAACA
GCCCTATTTGCTTCCACCAGTTTGCTGTTGAGCAATTGGGATGTTATCTT
TCTGCTTAACTGGCTGTGGTGGGTGTTCGGATTTTTATATTCTGAATTTG
GTTAATAGCACTAAATTGAGTTGTGAAGTTTATAGACCAGCTGCTGGATG
TCAAAGTTGGTGGTTTTAATACATTTGGAAGCTCATTT
back to top