DC900366

Overview
NameDC900366
Unique NameDC900366
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length394
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionDC900366 VSS Citrus sinensis cDNA clone VS28934 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900366 ID=DC900366|Name=DC900366|organism=Citrus sinensis|type=EST|length=394bp
CCAGACAATGGTCCTAAATGGGATTCCACTACAGCTGGCAGAAGATGAGG
GTATCCCGAAGTTAGATCCTGTCCGTGTTGATGTGAATTCTCCAATATAC
ATCACTCATTTATCAATTGCATTCATAGTATTCCCAAACTTCAGTGCTAG
AGCTTGTGTAGTATGACATCTCTTAAGTCTCTTAGAAAGAAATAAGGGCT
ATATGTGGTCACCAGTCAAGGTTCATAGTTTGCAGAATAGTTAATGTATG
GTTACAATAATCCTGAGCAATTGTATCTATAACTGTGTAATAGTGTTTTT
TGGGTAATAAGTTTTGCAATTAACAATGCAGTGTAAATGTTTTTGCTGTC
ATTTACTACTCATAATACCCTGCATATTTACTTGAGACCTTTTT
back to top