DC900361

Overview
NameDC900361
Unique NameDC900361
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length379
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900361_ssr1 microsatellite DC900361_ssr1:1..82. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2509 contig Csv1_Contig2509:364..742. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900361 VSS Citrus sinensis cDNA clone VS28926 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900361 ID=DC900361|Name=DC900361|organism=Citrus sinensis|type=EST|length=379bp
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACTTGACTGTGCTTTCTTG
CAAACACTCGTACCATTCTGAGTGCATAAACAATTGGTTGAAAATAAACA
AGGTCTGTCCTGTTTGCAGTGCCGAGGTCTCCACTTCTGGGCACAGTTAN
NANATCGATGAAGTCTCCTTCTCTGTTAGACAAAGAAAGAAAAAAGTCCT
GCACTGCTTATACTGATACTGAATGATATAATTGCGGTGCTTCTTTAATC
CTATGTAGACTAAGAAAAAAAAGACACCTGCTTGTATACAATTCTTTAAA
TGAAATATTTCATGCCCACCTTTGGAATT
back to top