DC900356

Overview
NameDC900356
Unique NameDC900356
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length343
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionDC900356 VSS Citrus sinensis cDNA clone VS28918 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900356 ID=DC900356|Name=DC900356|organism=Citrus sinensis|type=EST|length=343bp
GATCGAGGGACCAAAAGTCCCTCCGTCGCCCGGTTGCTGCACGGCGGTGA
AAGGAGCCGACATTCCCTGTGTTTGTGGCCTCGTTACAAGAGAGGTAGAG
AAGATTATTAGTATGGAGAAGGTGGTTTTTGTAGCACGTAAATGCGGTCT
CACTGTTAAACCTGGCCTGAAATGTGGAAGCTACACAGTCCCACCAAAGC
GGTTGACATAAGACGTGCTGGCAAGAATCACAAAAGCTAGCTATTTTGTT
ATAGAAACTATATATGAATAATAATGTGAATTTTTCCTTTTTTTAGTCTG
CATCTTCCTTTTCTTTTTAATATATAAAAATTTCTATTTTCTC
back to top